Basics
DNA cycle sequencing in our lab is performed using ABI BigDye v1.1 terminator chemistry. Our 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) is a multi-color fluorescence-based DNA analysis systems fully automated from sample loading to data analysis. Standard sequencing reactions usually yield 700-900 bp if the DNA and primer quality and quantity are optimum.
How does it work?
DNA sequencing technologies- Jonathan Weissman(UCSF/HHMI) ( 2011)
Sequencing Primer Design
For the best results:
- Design your primer at least 50 bases upstream of the region of interest.
- If using the same primer for both PCR and sequencing, then avoid generating/remove primer-dimers in PCR.
- Ensure there is a single annealing site for your primer. Check the Troubleshooting section.
- Primers should be 18 to 25 bases in length.
- Tm of primer should be at least 50 ºC at 2.5 mM MgCl2 and 0.2 mM primer
- G-C content should be between 35% and 65%, 50% would be the best.
- Avoid hairpin loops and long (more than 3) runs of any base.
Sanger Sequencing reaction procedure
We use the ABI Big Dye v1.1 terminator cycle sequencing chemistry to perform DNA sequencing. Conditions for the standard sequencing reaction are: annealing temperature 50 °C, extension 60 °C, 2.5mM MgCl2 and primer concentration is 0.2 mM. After the completion of the sequencing reaction, excess dye terminators are removed using magnetic beads and the purified reaction is placed in the 3730 DNA automated sequencer.
On the Machine
The capillary electrode is immersed in the DNA sample, current is applied and the negatively charged DNA fragments enter the capillary by a process called electrokinetic injection. Any residual reagents and contaminants will also enter the capillary, occasionally causing the sample to run in an abnormal way. It is imperative that the DNA is very clean or the reaction may fail.
The capillary is then immersed in the running buffer, an electrical current is applied and the DNA fragments then migrate towards the detection window and the fluorescence of the di-deoxy-terminating base is measured. The software then determines the bases as they are detected.
Mobix Lab Webinars
Interpreting Sanger Sequencing results
No-signal symptoms, causes and solutions
Shorter than expected read length
Multiple Peaks
Sample Submission
Procedure for Sample Submission
Both the DNA sample and the primer must be diluted in water and quantified either by fluorescence dye, agarose gel or OD 260nm (but only if no RNA or other contaminants are present).The 260/230 ratio should be between 1.7 and 2, while the 260/280 ratio around 1.8.
We require 5 µl of DNA (1 ng/ul for every 100 bp to template) and 5 µl of primer (1 pmol/µl = 1 µM) for EACH reaction in 1.5 ml eppendorf tubes. The Tm of the primer should be greater than 50 °C and the length should be 18 – 25 bases for optimum DNA sequencing. We have some common primers available for sequencing free of charge (please check to see if the primer you require is on this list).
Please write DNA and primer name on the top of the tube exactly as it is written in the submission form.
McMaster researchers may drop off samples and sequencing primers outside our lab (HSC-3N4) Monday to Friday from 9 a.m. until 2 p.m.
External customers should send DNA samples and sequencing primers by overnight courier at room temperature. Tubes should be sealed with parafilm and shipped in a padded envelope to the following address:
McMaster Genomics Facility
Health Sciences Centre, Rm 3N4
1200 Main St. W.
Hamilton, ON
L8N 3Z5
Template Preparation
The DNA concentration must be quantified either by fluorescence dye, agarose gel against Mass Ruler, or OD 260nm (but only if it is clean and no chomosomal DNA and/or RNA, primer-dimers, phenol, urea, EDTA, carbohyrates, Guanidine Cloride and othres are present (see To NanoDrop or Not to NanoDrop webinar and Contaminant limits ).
Too much DNA or too little DNA will sometimes cause the reaction to fail. The reaction can tolerate a range of concentrations, but the best results will be obtained by giving us the requested amount. To avoid misleading results due to chromosomal DNA contamination and RNA contamination, we recommend running samples on an agarose gel against a DNA ladder or Mass Ruler with known DNA mass for each band (FroggaBio DNA ladders).
In our lab, DNA sequencing works best when the template concentration is 1ng/µl for every 100 bases of the template.
PCR PRODUCTS: Do not forget to remove primers! Qiagen column (or similar), or gel purification work well.
Check the DNA amount after purification by running 1-5 µl of DNA on an agarose gel against a Mass Ruler.
PLASMID DNA: DNA plasmid samples must be clean and of high quality. We recommend using a purification kit that is suitable for capillary sequencing. The DNA concentration should be determined accurately. Alkaline lysis mini-prep methods should include an RNase digestion followed by phenol extraction and iso-propanol precipitation to receive optimal sequencing results.
LARGE DNA: For large DNA templates such as BACs (bacterial artificial chromosomes), bacteriophages, cosmids and fosmids, successful sequencing requires that the DNA be free of any contaminants since a large amount of DNA must be used. We suggest using standard alkaline lysis, followed by RNase treatment, phenol:chloroform extraction, iso-propanol precipitation, and ethanol wash in order to isolate high-quality DNA.
For the best results please provide DNA at concentration: 1ng/µl for every 100 bases of a template.
Following DNA concentrations are suggested:
| PCR product | 100 – 200 bp | 1-3 ng/µl |
| 200-500 bp | 2-6 ng/µl | |
| 500-1000 bp | 5-10 ng/µl | |
| 1000-2000 bp | 10-20 ng/µl | |
| >2000 bp | 20-100 ng/µl | |
| Plasmid DNA | up to 10 kb | 100 ng/µl |
| Large ds-DNA | 10 kb-40 kb | 200-500 ng/µl |
| Bacterial Genomic DNA | up to 10 Mb | 2000-3000 ng/µl* |
*These reactions are more expensive (visit prices) and usually yield 100 to 300 bases of sequence.
Turnaround Time
Turnaround time is usually 48 hours (Weekdays only) from the time samples arrive at the laboratory.
Forms
SANGER SEQUENCING ORDER FORMS
To download the sequencing order form for submissions from McMaster:
To download the sequencing order form for external submissions,
Common Sequencing Primers
| Name | Sequence (5′ – 3′) | Size |
|---|---|---|
| M13 F | gta aaa cga cgg cca gt | 17 |
| M13 F(-40) | gtt ttc cca gtc acg ac | 17 |
| M13 Rev | cag gaa aca gct atg ac | 17 |
| M13 Rev-48 | agc gga taa caa ttt cac aca gga | 24 |
| Sp 6 | gat tta ggt gac act ata g | 19 |
| T7 | taa tac gac tca cta tag gg | 20 |
| T7 term | gct agt tat tgc tca gcg g | 19 |
| T3 | att aac cct cac taa agg ga | 20 |
| BGH | tag aag gca cag tcg agg | 18 |
| pBr322 (BamHI) | atg cgt ccg gcg tag a | 16 |
| pGEX 5′ | ggg ctg gca agc cac gtt tgg tg | 23 |
| pGEX 3′ | ccg gga gct gca tgt gtc aga gg | 23 |
| SK | tct aga act agt gga tc | 17 |
| KS | cga ggt cga cgg tat cg | 17 |
| -96gIII | ccc tca tag tta gcg taa cg | 20 |
| lgtII For. | ggt ggc gac gac tcc tgg agc ccg | 24 |
| lgtII Rev. | ttg aca cca gac caa ctg gta atg | 24 |
| pDONR 201 F | ttaacgctagcatggatct | 19 |
| pDONR 201 R | aacatcagagattttgagacac | 22 |
| TnN | ttt ttt ttt ttt ttt ttt ttv | 21 |
Results Delivery
Results Delivery Format
The results are e-mailed as a text file and/or .ab1 data file. If you request “with editing”, our staff will analyze the sequences in order to correct miscalled or ambiguous bases. These changes are annotated by lower-case letters. Presently we are not providing printouts of the electropherograms.
Sequence Scanner 2 Software (Freeware for viewing DNA electropherogram sequencing (*.ab1) files)
Interpreting Sanger Sequencing results webinar
Quality Assurance
The Mobix Lab diligently delivers the highest quality sequence data possible. The pGEM sequence reaction is used as a daily sequencing quality control. We will gladly repeat failed sequencing reactions if it is determined that there was a problem with the sequencing procedure in our lab. Please advise us about a problem within 48 hours of receiving your results.
Please note that if the results show that the sequencing problem was not related to a sequencing set-up problem, but instead a DNA or primer problem, you may be charged for the additional reactions. Please check our Troubleshooting section.
Troubleshooting
Molecular BIiology Counselling and Troubleshooting
If you are having trouble with your Sanger sequencing, we offer our troubleshooting expertise in molecular biology to anyone who would like help with their sequencing, oligo ordering, PCR, or cloning questions.
Please make an appointment with us by contacting the lab by phone or email and bring any relevant information (laptop, lab book, etc.) with you when you come.
A good website for troubleshooting sequencing results can be found here: http://www.etonbio.com/sequencing/troubleshooting.php
To NanoDrop or Not to NanoDrop webinar
No Signal/ No Data Webinar
Result is obtained when the signal strength of the fluorescent termination products is too low for the computer software to call bases. Below are common reasons why this occurs.
| Reasons_for_”no data” result | Insufficient amount of DNA template or too much DNA (see DNA concentration) |
| Poor quality of DNA template (see Contaminants affecting DNA sequencing below) | |
| Insufficient primer concentration (or no primer added) | |
| Primer Tm is less than 50 °C, the annealing temperature of the sequencing reaction is 50 °C | |
| Template does not have primer site–make sure that the correct primer is chosen for the vector being used. | |
| Primer does not anneal well to priming site or priming site is masked by a hairpin. A set of primers may produce a PCR product, but one primer may not anneal as efficiently and therefore not work well for DNA sequencing, which is linear amplification, unlike PCR which is exponential amplification. |
Short Read Webinar
| Top-heavy data | Excess DNA template or primer or salt in the sequencing reaction results in top-heavy data because balance of the sequencing reaction is shifted towards generation of shorter products. DNA purification using QIAEXII kit usually results in top-heavy data. |
| Gradual decrease in the signal | Repetitive DNA region |
| Abrupt decrease in the signal | Region of secondary structure or template sequence idiosyncrasies |
Multiple Peaks in the Sequence Webinar
| PCR products | At the beginning of the sequence – primer-dimer sequence. |
| All the way – PCR product was not purified from primers. Or significantly degraded primer causing annealing of that primer to more than one locus of the template. If no-signal with the second PCR primer – the primer with multiple signals is amplifying both the forward and the reverse. After some good sequence – Insertion/Deletion (frameshift) mutation |
|
| Plasmid DNA | After some good sequence – more than 1 colony picked. |
| Slippage after homopolymer region in template. | |
| Noisy sequence | The signal is too low (see “no data“) |
| Signal is too high causing detector saturation, as a result, the software can’t call bases properly. Signal pull-ups most noticeable under T base | |
| Contaminated template (see Contaminants affecting DNA sequencing) | |
| Multiple priming sites or multiple primers | |
| N-1 signal – sequencing primer contaminated with degraded primer | |
| “Spikes” in the sequence | Degraded DNA. Nuclease contamination and repeated freeze-thaw cycles can result in degradation of DNA. Spike location in these samples will not change the position after re-run. |
| Contaminated template (see Contaminants affecting DNA sequencing) | |
| Problem with the polymer on 3730-Genetic analyzer. Contact Mobix lab within 24 hour of receiving this kind of result and we will repeat the run free of charge. |
Contaminants Affecting DNA sequencing
The sequencing reaction will fail if there is more than:
| A) | 1mg RNA – 1ml E.coli culture gives 1 to 5 mg plasmid DNA but 100 to 500 mg RNA! | |
| B) | 0.3% PEG | |
| C) | 0.5mM NaAc | |
| D) | 1.25% EtOH | |
| E) | 0% phenol – not even a trace! | |
| F) | 0% chloroform | |
| G) | 5mM CsCl | |
| H) | 5mM EDTA – dissolve your DNA in water or 10mM Tris pH8.5 |
- When you treat your DNA with RNase you must remove all the digested RNA.
- Always wash DNA pellets with 70% ethanol, especially after phenol or chloroform extraction.
- Pipette off as much ethanol as possible from DNA pellets and make sure that all the ethanol has evaporated before resuspending the DNA.
- Please use dH20 or 0.1X TE to resuspend DNA intended for sequencing.
Prices
| Service | McMaster Account | External Customers |
|---|---|---|
| Standard sequencing reaction – up to 800 bases read from good quality DNA (template less than 20kb) No Editing | $8.00 | $12.00 |
| Hairpin, AT-rich, Lambda Protocols sequencing | $10.00 | $14.00 |
| Standard sequencing reaction – up to 800 bases read from good quality DNA (template less than 20 kb) With Editing | $15.00 | $18.00 |
| Large template sequencing, BAC DNA and bacterial genomic DNA (with editing) | $25.00 | $28.00 |
| up to 95 samples, DNA and primer (5 ul each) premixed in Standard 96 well Semi-Skirted plate with one well left empty (H12) for pGEM control.
MobixLab technician approval required. Submission form in Excel, No Editing Internal Customer Plate submission form or External Customer plate submission form |
Standard Sequencing $700.00 |
Standard Sequencing $900.00 |
| Delivery Charge | Not applicable | Not applicable |
Email any inquiries to mobixlab@mcmaster.ca